Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLL3.7_hsa-miR-30c
(Plasmid #25797)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25797 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.7
  • Backbone size w/o insert (bp) 7650
  • Vector type
    Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hsa-miR-30c
  • Alt name
    miR-30c
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    210

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The pLL3.7 cassette containing the U6 promoter and a control short hairpin was replaced by a cassette containing the U6 promoter and an approx 300 bp genomic fragment for expression of the mature miRNA from pSIREN-RetroQ-miRNA expression vectors, kindly provided by Dr. B. Ramratnam, Brown University

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7_hsa-miR-30c was a gift from Judy Lieberman (Addgene plasmid # 25797 ; http://n2t.net/addgene:25797 ; RRID:Addgene_25797)
  • For your References section:

    miR-34a contributes to megakaryocytic differentiation of K562 cells independently of p53. Navarro F, Gutman D, Meire E, Caceres M, Rigoutsos I, Bentwich Z, Lieberman J. Blood. 2009 Sep 3. 114(10):2181-92. 10.1182/blood-2009-02-205062 PubMed 19584398