-
Purpose(Empty Backbone) SGC Empty backbone for bacterial expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26098 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCW-LIC
-
Backbone manufacturerStructural Genomics Consortium
- Backbone size (bp) 6980
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- Three consecutive Taq promoters, 2 active (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pCW-SEQ-fwd (ACATCGTATAACGTTACTGG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-LIC was a gift from Cheryl Arrowsmith (Addgene plasmid # 26098 ; http://n2t.net/addgene:26098 ; RRID:Addgene_26098)