Skip to main content

pNIC-CH
(Plasmid #26117)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26117 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNIC-CH
  • Backbone manufacturer
    SGC Oxford
  • Backbone size (bp) 7218
  • Vector type
    Bacterial Expression
  • Promoter T7-lacO
  • Tag / Fusion Protein
    • His (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843

Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNIC-CH was a gift from Opher Gileadi (Addgene plasmid # 26117 ; http://n2t.net/addgene:26117 ; RRID:Addgene_26117)