This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26105)


Item Catalog # Description Quantity Price (USD)
Plasmid 26105 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size (bp) 5330
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    For plasmid propagation and cloning use any E. coli strain not expressing T7 RNA polymerase. For expression, use a strain that expresses T7 RNA polymerase, e.g. BL21(DE3).
  • Copy number
    High Copy


  • Gene/Insert name
  • GenBank ID
  • Tag / Fusion Protein
    • TEV - His6 - Flag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ligation-Independent cloning; cut with BfuAI (destroyed during cloning)
  • 3′ cloning site Ligation-Independent cloning; cut with BfuAI (destroyed during cloning)
  • 5′ sequencing primer T7F
  • 3′ sequencing primer T7R
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Primers for LIC cloning:

Upstream: add TTAAGAAGGAGATATACTATG to the 5’ end (ATG in-frame with the desired coding

Downstream: add GATTGGAAGTAGAGGTTCTCTGC to 5’ end of downstream primer (no termination codon!)

Detailed cloning method available in the paper (Savitsky et al., J Struct Biol., 2010)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNIC-CTHF was a gift from Opher Gileadi (Addgene plasmid # 26105 ; ; RRID:Addgene_26105)
  • For your References section:

    High-throughput production of human proteins for crystallization: The SGC experience. Savitsky P, Bray J, Cooper CD, Marsden BD, Mahajan P, Burgess-Brown NA, Gileadi O. J Struct Biol. 2010 Jun 10. ():. 10.1016/j.jsb.2010.06.008 PubMed 20541610