Skip to main content

HRE-luciferase
(Plasmid #26731)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26731 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL2
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hypoxia Responsive Elements (3)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer Luc_N_Rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Three hypoxia response elements (24-mers) from the Pgk-1 gene upstream of firefly luciferase.

HRE: TGTCACGTCCTGCACGACTCTAGT

Note that one of the elements is a 22/24 match for the above sequence. This difference is not known to affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HRE-luciferase was a gift from Navdeep Chandel (Addgene plasmid # 26731 ; http://n2t.net/addgene:26731 ; RRID:Addgene_26731)
  • For your References section:

    PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a). Emerling BM, Weinberg F, Liu JL, Mak TW, Chandel NS. Proc Natl Acad Sci U S A. 2008 Feb 19. 105(7):2622-7. 10.1073/pnas.0706790105 PubMed 18268343