Psicheck2 UBE2f full length 3'UTR
(Plasmid
#26991)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepsiCHECK-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6300
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUBE2f Full length 3' UTR
-
Alt nameUBE2f
-
SpeciesH. sapiens (human)
-
Insert Size (bp)700
-
Entrez GeneUBE2F (a.k.a. NCE2)
-
Tag
/ Fusion Protein
- Renilla Luciferase (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer Rluc-F
- 3′ sequencing primer psiCHECK2-R (CGAGGTCCGAAGACTCATTT) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Psicheck2 UBE2f full length 3'UTR was a gift from Joan Massague (Addgene plasmid # 26991 ; http://n2t.net/addgene:26991 ; RRID:Addgene_26991) -
For your References section:
Endogenous human microRNAs that suppress breast cancer metastasis. Tavazoie SF, Alarcon C, Oskarsson T, Padua D, Wang Q, Bos PD, Gerald WL, Massague J. Nature. 2008 Jan 10. 451(7175):147-52. 10.1038/nature06487 PubMed 18185580