-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27106 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEntr2B
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2300
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namereverse tetracycline transactivator
-
Alt namertTA
-
Insert Size (bp)1100
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCTACAAACTCTTCCTGTTAGT
- 3′ sequencing primer AGAGATTTTGAGACACGGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gateway L1L3 entry vector containing the rtTA regulator, rtTA2s-M2, an optimized version of the rtTA transactivator (see PubMedID 10859354 for details). Promoters can be inserted using PacI and SbfI. Does not contain insulator sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEnt L1L3 rtTA-3 was a gift from Edward Hsiao (Addgene plasmid # 27106 ; http://n2t.net/addgene:27106 ; RRID:Addgene_27106) -
For your References section:
Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice. Hsiao EC, Nguyen TD, Ng JK, Scott MJ, Chang WC, Zahed H, Conklin BR. Stem Cell Res Ther. 2011 Mar 4. 2(2):11. 10.1186/scrt52 PubMed 21375737