Skip to main content
Addgene

pHR-ZIP(FF)
(Plasmid #27135)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27135 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR'
  • Backbone size w/o insert (bp) 9000
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259)
  • Alt name
    CD3zeta ITAMs phosphorylation reporter
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    2847
  • Mutation
    Tyrosines in ITAMS 1-3 mutated to phenylalanines (Y72F, Y83F, Y111F, Y123F, Y142F, Y153F in the insert)
  • Entrez Gene
    ZAP70 (a.k.a. ADMIO2, IMD48, SRK, STCD, STD, TZK, ZAP-70)
  • Entrez Gene
    Cd247 (a.k.a. 4930549J05Rik, A430104F18Rik, Cd3, Cd3-eta, Cd3-zeta, Cd3h, Cd3z, Cd3zeta, T3z, Tcrk, Tcrz)
  • Tags / Fusion Proteins
    • eGFP
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCTTCCCGAGCTCTATAAAAGAGC
  • 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-ZIP(FF) was a gift from Ron Vale (Addgene plasmid # 27135 ; http://n2t.net/addgene:27135 ; RRID:Addgene_27135)
  • For your References section:

    Imaging T-cell receptor activation reveals accumulation of tyrosine-phosphorylated CD3{zeta} in the endosomal compartment. Yudushkin IA, Vale RD.. Proc Natl Acad Sci U S A. 2010 Dec 21;107(51):22128-33. 10.1073/pnas.1016388108 PubMed 21135224