-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS416GAL
- Backbone size w/o insert (bp) 5000
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTDP-43
-
SpeciesH. sapiens (human)
-
MutationMethionine 337 mutated to Valine (M337V)
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
-
Tag
/ Fusion Protein
- YFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer pRSGal-Fwd GTTAATATACCTCTATACTTTAACGTCAAGGAGA
- 3′ sequencing primer T3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS416 Gal M337V YFP was a gift from Aaron Gitler (Addgene plasmid # 27449 ; http://n2t.net/addgene:27449 ; RRID:Addgene_27449) -
For your References section:
TDP-43 is intrinsically aggregation-prone, and amyotrophic lateral sclerosis-linked mutations accelerate aggregation and increase toxicity. Johnson BS, Snead D, Lee JJ, McCaffery JM, Shorter J, Gitler AD. J Biol Chem. 2009 Jul 24. 284(30):20329-39. 10.1074/jbc.M109.010264 PubMed 19465477