-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNFalpha
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)707
-
GenBank IDNM_013693
-
Entrez GeneTnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer ggccagatctagcacagaaagcatgatc
- 3′ sequencing primer ggttcccgggtctcagagcaatgactccaaagta (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-TNFalpha was a gift from Jennifer Stow (Addgene plasmid # 28089 ; http://n2t.net/addgene:28089 ; RRID:Addgene_28089) -
For your References section:
Subcompartments of the macrophage recycling endosome direct the differential secretion of IL-6 and TNFalpha. Manderson AP, Kay JG, Hammond LA, Brown DL, Stow JL. J Cell Biol. 2007 Jul 2. 178(1):57-69. 10.1083/jcb.200612131 PubMed 17606866