Skip to main content

pMSP12::dsRed2
(Plasmid #30171)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30171 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFPV27
  • Backbone manufacturer
    Ramakrishnan et al., 2000
  • Backbone size w/o insert (bp) 4981
  • Vector type
    Mycobacteria expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mycobacterium Strong Promoter (MSP)
  • Species
    M. marinum
  • Insert Size (bp)
    500
  • Tag / Fusion Protein
    • dsRed2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
  • 3′ sequencing primer dsRed1-N
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was derived from pMSP12::GFP (Addgene plasmid # 30167) by replacing the GFP with dsRed2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSP12::dsRed2 was a gift from Lalita Ramakrishnan (Addgene plasmid # 30171 ; http://n2t.net/addgene:30171 ; RRID:Addgene_30171)
  • For your References section:

    Superinfecting mycobacteria home to established tuberculous granulomas. Cosma CL, Humbert O, Ramakrishnan L. Nat Immunol. 2004 Aug . 5(8):828-35. 10.1038/ni1091 PubMed 15220915