Skip to main content

pTEC20
(Plasmid #30179)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30179 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFPV27
  • Backbone manufacturer
    Ramakrishnan et al., 2000
  • Backbone size w/o insert (bp) 4981
  • Vector type
    Mycobacteria expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mycobacterium Strong Promoter (MSP)
  • Alt name
    pMSP12::mKate2
  • Species
    M. marinum
  • Insert Size (bp)
    500
  • Tag / Fusion Protein
    • mKate2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
  • 3′ sequencing primer Kan-Rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with mKate2. The mKate2 ORF is present at bp# 105-803.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTEC20 was a gift from Lalita Ramakrishnan (Addgene plasmid # 30179 ; http://n2t.net/addgene:30179 ; RRID:Addgene_30179)
  • For your References section:

    Evaluation of the pathogenesis and treatment of Mycobacterium marinum infection in zebrafish. Takaki K, Davis JM, Winglee K, Ramakrishnan L. Nat Protoc. 2013 Jun;8(6):1114-24. doi: 10.1038/nprot.2013.068. Epub 2013 May 16. 10.1038/nprot.2013.068 PubMed 23680983