pTAL2
(Plasmid
#31033)
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR8-GW modified
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2676
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH10B/LB+antibiotics
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALE fusion
-
SpeciesXanthamonas oryzae
-
Insert Size (bp)2098
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TAL_F1 (ttggcgtcggcaaacagtgg)
- 3′ sequencing primer TAL_R2 (ggcgacgaggtggtcgttgg) (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gateway compatible vector for assembly of fusion ready, full length TAL effector genes by Golden Gate cloning. Lacks a stop codon and contains both SD and Kozak sequences immediately upstream the initial ATG. Designed for TAL DNA-binding domains to be fused with another protein domain of the user's choice
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTAL2 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31033 ; http://n2t.net/addgene:31033 ; RRID:Addgene_31033) -
For your References section:
Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687