Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDEST-HemmarG
(Plasmid #31221)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31221 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB Survival™ 2 T1R Cells @ 37C.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD4-tdGFP
  • Species
    H. sapiens (human), D. melanogaster (fly); Aequorea victoria
  • Insert Size (bp)
    2340
  • Mutation
    Fusion of signal peptide of Drosophila Akh gene, human CD4 transmembrane domain, EGFP, GFP, and Kir2.1 ER exit signal.
  • Entrez Gene
    CD4 (a.k.a. CD4mut)
  • Tags / Fusion Proteins
    • CD4 (N terminal on insert)
    • EGFP/GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ACTGCAACTACTGAAATCTGCC
  • 3′ sequencing primer GGCGCACAGAAATGATTACAAC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdGFP

The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-HemmarG was a gift from Yuh-Nung Jan (Addgene plasmid # 31221 ; http://n2t.net/addgene:31221 ; RRID:Addgene_31221)
  • For your References section:

    Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Han C, Jan LY, Jan YN. Proc Natl Acad Sci U S A. 2011 May 23. ():. 10.1073/pnas.1106386108 PubMed 21606367