-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLOVE
-
Backbone manufacturerRamalho-Santos Laboratory
- Backbone size w/o insert (bp) 7263
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemmu-miR302/367
-
Alt nameNone
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)690
-
MutationNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenomic DNA
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
WARNING: This plasmid is highly unstable. You may need to screen several DNA preps to isolate the intact construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLOVE-miR302/367 was a gift from Ed Morrisey (Addgene plasmid # 31310 ; http://n2t.net/addgene:31310 ; RRID:Addgene_31310) -
For your References section:
Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency. Anokye-Danso F, Trivedi CM, Juhr D, Gupta M, Cui Z, Tian Y, Zhang Y, Yang W, Gruber PJ, Epstein JA, Morrisey EE. Cell Stem Cell. 2011 Apr 8. 8(4):376-88. 10.1016/j.stem.2011.03.001 PubMed 21474102
Map uploaded by the depositor.