Skip to main content

pLOVE-miR302/367
(Plasmid #31310)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31310 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLOVE
  • Backbone manufacturer
    Ramalho-Santos Laboratory
  • Backbone size w/o insert (bp) 7263
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mmu-miR302/367
  • Alt name
    None
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    690
  • Mutation
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genomic DNA
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

WARNING: This plasmid is highly unstable. You may need to screen several DNA preps to isolate the intact construct.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLOVE-miR302/367 was a gift from Ed Morrisey (Addgene plasmid # 31310 ; http://n2t.net/addgene:31310 ; RRID:Addgene_31310)
  • For your References section:

    Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency. Anokye-Danso F, Trivedi CM, Juhr D, Gupta M, Cui Z, Tian Y, Zhang Y, Yang W, Gruber PJ, Epstein JA, Morrisey EE. Cell Stem Cell. 2011 Apr 8. 8(4):376-88. 10.1016/j.stem.2011.03.001 PubMed 21474102