-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3998
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagRFP657
-
Insert Size (bp)717
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTagRFP657-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31959 ; http://n2t.net/addgene:31959 ; RRID:Addgene_31959) -
For your References section:
Far-red fluorescent protein excitable with red lasers for flow cytometry and superresolution STED nanoscopy. Morozova KS, Piatkevich KD, Gould TJ, Zhang J, Bewersdorf J, Verkhusha VV. Biophys J. 2010 Jul 21;99(2):L13-5. 10.1016/j.bpj.2010.04.025 PubMed 20643047