- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSub201
- Backbone size w/o insert (bp) 8310
- 
              Vector typeMammalian Expression, AAV ; Adeno-Associated Virus
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)NEB Stable
- 
              Growth instructionsUsers must confirm the absence of deletions (recombinations) in this vector by diagnostic digests. (1) An AhdI digest should produce the following pattern of bands: 1557 bp, 1478 bp and 1334 bp. (2) An SrfI digest should produce the following pattern of bands: 2801 bp and 1546 bp. Please consult the associated publication listed below for an example gel image. *See Addgene note below regarding the band sizes.
- 
            Copy numberLow Copy
Gene/Insert
- 
                Gene/Insert nameGFP
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Multiple (see map) (not destroyed)
- 3′ cloning site Multiple (see map) (not destroyed)
- 5′ sequencing primer TGGCACCAAAATCAACGGGACTTTCCAAAATGT
- 3′ sequencing primer AAAACCTCCCACACCTCCCCCTGAAC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that Addgene detected a 22 bp deletion which may affect packaging efficiency but does not affect the overall plasmid function. Please screen multiple colonies as noted by the depositor in the growth instructions. The exact number of bases is different compared to the Addgene verified sequence, however they are approximately the same size.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pscAAV-GFP was a gift from John T Gray (Addgene plasmid # 32396 ; http://n2t.net/addgene:32396 ; RRID:Addgene_32396)
- 
                For your References section: Design and Construction of Functional AAV Vectors. Gray JT, Zolotukhin S. Methods Mol Biol. 2011;807:25-46. 10.1007/978-1-61779-370-7_2 PubMed 22034025
 
    
 
                         
             
            