pBAD/HisB-PAmKate
(Plasmid
#32691)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD/His-B
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4074
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePAmKate
-
Alt namephotoactivatable dark-to-farred fluorescent protein
-
Insert Size (bp)702
-
MutationF84W/S148N/S165G compared to mKate (but numbering relative to EGFP).
- Promoter araB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer atgccatagcatttttatcc
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD/HisB-PAmKate was a gift from Vladislav Verkhusha (Addgene plasmid # 32691 ; http://n2t.net/addgene:32691 ; RRID:Addgene_32691) -
For your References section:
Superresolution imaging of multiple fluorescent proteins with highly overlapping emission spectra in living cells. Gunewardene MS, Subach FV, Gould TJ, Penoncello GP, Gudheti MV, Verkhusha VV, Hess ST. Biophys J. 2011 Sep 21;101(6):1522-8. Epub 2011 Sep 20. 10.1016/j.bpj.2011.07.049 PubMed 21943434