Skip to main content
Addgene
Open Menu

pEGFP-TDAG51
(Plasmid #32699)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32699 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 32699-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 32699-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human tdag51
  • Alt name
    phlda1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    792
  • GenBank ID
    GenBank: AAH18929.3
  • Entrez Gene
    PHLDA1 (a.k.a. DT1P1B11, PHRIP, TDAG51)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer 5'd[CATGGTCCTGCTGGAGTTCGTG]
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-TDAG51 was a gift from Richard C. Austin (Addgene plasmid # 32699 ; http://n2t.net/addgene:32699 ; RRID:Addgene_32699)

  • For your References section:

    TDAG51 is induced by homocysteine, promotes detachment-mediated programmed cell death, and contributes to the cevelopment of atherosclerosis in hyperhomocysteinemia. Hossain GS, van Thienen JV, Werstuck GH, Zhou J, Sood SK, Dickhout JG, de Koning AB, Tang D, Wu D, Falk E, Poddar R, Jacobsen DW, Zhang K, Kaufman RJ, Austin RC. J Biol Chem. 2003 Aug 8;278(32):30317-27. Epub 2003 May 8. 10.1074/jbc.M212897200 PubMed 12738777
Related items:
Commonly requested with: