pEGFP-TDAG51
(Plasmid
#32699)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman tdag51
-
Alt namephlda1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)792
-
GenBank IDGenBank: AAH18929.3
-
Entrez GenePHLDA1 (a.k.a. DT1P1B11, PHRIP, TDAG51)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer 5'd[CATGGTCCTGCTGGAGTTCGTG] (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-TDAG51 was a gift from Richard C. Austin (Addgene plasmid # 32699 ; http://n2t.net/addgene:32699 ; RRID:Addgene_32699) -
For your References section:
TDAG51 is induced by homocysteine, promotes detachment-mediated programmed cell death, and contributes to the cevelopment of atherosclerosis in hyperhomocysteinemia. Hossain GS, van Thienen JV, Werstuck GH, Zhou J, Sood SK, Dickhout JG, de Koning AB, Tang D, Wu D, Falk E, Poddar R, Jacobsen DW, Zhang K, Kaufman RJ, Austin RC. J Biol Chem. 2003 Aug 8;278(32):30317-27. Epub 2003 May 8. 10.1074/jbc.M212897200 PubMed 12738777