-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 33014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCCL-cppt-PGK-WPRE
-
Backbone manufacturerMalin Parmar
- Backbone size w/o insert (bp) 7041
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameForkhead box A2
-
Alt nameFoxa2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1380
-
MutationH10L
-
GenBank IDNM_010446.2 (see note below)
-
Entrez GeneFoxa2 (a.k.a. HNF3-beta, HNF3beta, Hnf-3b, Hnf3b, Tcf-3b, Tcf3b)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GACATACCGACGCAGCTACA
- 3′ sequencing primer CCGGTAGAAAGGGAAGAGGT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that Addgene's sequencing data shows a H10L mutation is present compared to the depositor's sequence. This mutation is a known variant of mouse Foxa2 (GenBank: CAA52891.1).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.PGK.mFoxa2 was a gift from Malin Parmar (Addgene plasmid # 33014 ; http://n2t.net/addgene:33014 ; RRID:Addgene_33014) -
For your References section:
Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. 10.1073/pnas.1105135108 PubMed 21646515