-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 33780 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAD TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4127
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsGrow E. coli to early-log phase (OD600 = 0.3 ~ 0.4) in 50 mL of LB medium in a shaking incubator at 33 C. Add inducer along with all-trans retinal (5 microM from a 20 mM stock in ethanol) and conduct further growth in the dark. Harvest cells after 3.5 hours and wash with 30 mL of minimal medium (1x M9 salts, 0.4% glucose, pH 7). Resuspend cells in 5 mL minimal medium and use immediately or store at 4 C for later use.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProteorhodopsin Optical Proton Sensor
-
Alt namePROPS
-
Alt nameProteorhodopsin D97N
-
Speciesuncultured proteobacterium EBAC31A08
-
Insert Size (bp)801
-
MutationD97N
-
GenBank IDAF_279106
- Promoter AraBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJMK001 was a gift from Adam Cohen (Addgene plasmid # 33780 ; http://n2t.net/addgene:33780 ; RRID:Addgene_33780) -
For your References section:
Electrical spiking in Escherichia coli probed with a fluorescent voltage-indicating protein. Kralj JM, Hochbaum DR, Douglass AD, Cohen AE. Science. 2011 Jul 15;333(6040):345-8. 10.1126/science.1204763 PubMed 21764748