Skip to main content

pJMK001
(Plasmid #33780)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 33780 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4127
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Grow E. coli to early-log phase (OD600 = 0.3 ~ 0.4) in 50 mL of LB medium in a shaking incubator at 33 C. Add inducer along with all-trans retinal (5 microM from a 20 mM stock in ethanol) and conduct further growth in the dark. Harvest cells after 3.5 hours and wash with 30 mL of minimal medium (1x M9 salts, 0.4% glucose, pH 7). Resuspend cells in 5 mL minimal medium and use immediately or store at 4 C for later use.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Proteorhodopsin Optical Proton Sensor
  • Alt name
    PROPS
  • Alt name
    Proteorhodopsin D97N
  • Species
    uncultured proteobacterium EBAC31A08
  • Insert Size (bp)
    801
  • Mutation
    D97N
  • GenBank ID
    AF_279106
  • Promoter AraBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMK001 was a gift from Adam Cohen (Addgene plasmid # 33780 ; http://n2t.net/addgene:33780 ; RRID:Addgene_33780)
  • For your References section:

    Electrical spiking in Escherichia coli probed with a fluorescent voltage-indicating protein. Kralj JM, Hochbaum DR, Douglass AD, Cohen AE. Science. 2011 Jul 15;333(6040):345-8. 10.1126/science.1204763 PubMed 21764748