Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #34616)


Item Catalog # Description Quantity Price (USD)
Plasmid 34616 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9227
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Arch D95N
  • Alt name
    Archaerhodopsin 3
  • Species
    Halorubrum sodomense
  • Insert Size (bp)
  • Mutation
    Changed Aspartic Acid 95 to Asparagine
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACGGATCCGCCACCATGGAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMK004 was a gift from Adam Cohen (Addgene plasmid # 34616 ; ; RRID:Addgene_34616)
  • For your References section:

    Optical recording of action potentials in mammalian neurons using a microbial rhodopsin. Kralj JM, Douglass AD, Hochbaum DR, Maclaurin D, Cohen AE. Nat Methods. 2011 Nov 27. doi: 10.1038/nmeth.1782. 10.1038/nmeth.1782 PubMed 22120467