Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJMK004
(Plasmid #34616)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 34616 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FCK(1.3)
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9227
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arch D95N
  • Alt name
    Archaerhodopsin 3
  • Species
    Halorubrum sodomense
  • Insert Size (bp)
    777
  • Mutation
    Changed Aspartic Acid 95 to Asparagine
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACGGATCCGCCACCATGGAC
  • 3′ sequencing primer CTAATCGAATTCTTAGTCGGCGGCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMK004 was a gift from Adam Cohen (Addgene plasmid # 34616 ; http://n2t.net/addgene:34616 ; RRID:Addgene_34616)
  • For your References section:

    Optical recording of action potentials in mammalian neurons using a microbial rhodopsin. Kralj JM, Douglass AD, Hochbaum DR, Maclaurin D, Cohen AE. Nat Methods. 2011 Nov 27. doi: 10.1038/nmeth.1782. 10.1038/nmeth.1782 PubMed 22120467