pJMK001
(Plasmid #33780)

• Depositing Lab: Adam Cohen
• Publication: Kralj et al Science. 2011 Jul 15;333(6040):345-8.

Backbone

• Vector backbone: pBAD TOPO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4127
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Growth instructions: Grow E. coli to early-log phase (OD600 = 0.3 ~ 0.4) in 50 mL of LB medium in a shaking incubator at 33 C. Add inducer along with all-trans retinal (5 microM from a 20 mM stock in ethanol) and conduct further growth in the dark. Harvest cells after 3.5 hours and wash with 30 mL of minimal medium (1x M9 salts, 0.4% glucose, pH 7). Resuspend cells in 5 mL minimal medium and use immediately or store at 4 C for later use.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Proteorhodopsin Optical Proton Sensor
• Alt name: PROPS
• Alt name: Proteorhodopsin D97N
• Species: uncultured proteobacterium EBAC31A08
• Insert Size (bp): 801
• GenBank ID: AF_279106
• Promoter: AraBAD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• Supplemental Documents:
  • Imaging PROPS in E. coli
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry