Skip to main content

FOP-GFP
(Plasmid #35490)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35490 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK-GFP.WPRE
  • Backbone manufacturer
    Didier Trono
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    7xFOP-GFP
  • Species
    Synthetic
  • Promoter mutated 7xTCF/LEF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    In this plasmid, a synthetic mutated 7xTCF/LEF promoter sequence replaces the promoter sequence of the 7xTOP-GFP vector.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FOP-GFP was a gift from Ramesh Shivdasani (Addgene plasmid # 35490 ; http://n2t.net/addgene:35490 ; RRID:Addgene_35490)
  • For your References section:

    Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst D, Chen J, Morikawa T, Ogino S, Kirchner T, Shivdasani RA. Cancer Res. 2012 Feb 8. 10.1158/0008-5472.CAN-11-3222 PubMed 22318865