Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCDNA 3.1 Flag-rat-PTP1B
(Plasmid #35988)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35988 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5427
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    protein tyrosine phosphatase 1B
  • Alt name
    PTP1B
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1299
  • Entrez Gene
    Ptpn1 (a.k.a. Ptp)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer T7 FWD TAATACGACTCACTATAGGG
  • 3′ sequencing primer BGH Rev CCTCGACTGTGCCTTCTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    (EGFP)-PTP1B-HA construct was a gift from C. Arregui (University of San Martin, Buenos Aires, Argentina)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

A Kozak methionine initiator sequence and a Flag tag were added to the N terminus of rat PTP1B, which was amplified by PCR with the following primers: 5′-CTCGGATCCGCCACCATGGACTACAAGGACGACGATGACAAGAAGCTTGGGATGGAAATGGAGAAGGAATTCGAG-3′ and 5′-CTCTAGACTCGAGCGGCCGCTCAGTGAAAACATACCCGGTAACAG-3′. The PCR product was digested with BamHI and NotI and subsequently ligated into the corresponding sites of pCDNA3.1(+) (Invitrogen)

Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 889-910, indicating that the NheI and AflII sites are no longer present in the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA 3.1 Flag-rat-PTP1B was a gift from Anna Huttenlocher (Addgene plasmid # 35988 ; http://n2t.net/addgene:35988 ; RRID:Addgene_35988)
  • For your References section:

    Calpain 2 and PTP1B function in a novel pathway with Src to regulate invadopodia dynamics and breast cancer cell invasion. Cortesio CL, Chan KT, Perrin BJ, Burton NO, Zhang S, Zhang ZY, Huttenlocher A. J Cell Biol. 2008 Mar 10;180(5):957-71. 10.1083/jcb.200708048 PubMed 18332219