Skip to main content

pDDRFP-A1B1-DEVD
(Plasmid #36294)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36294 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone manufacturer
    Life Technologies
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ddRFPA1B1-DEVD
  • Alt name
    dimerization-dependent RFP caspase-3 sensor

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDDRFP-A1B1-DEVD was a gift from Robert Campbell (Addgene plasmid # 36294 ; http://n2t.net/addgene:36294 ; RRID:Addgene_36294)
  • For your References section:

    A fluorogenic red fluorescent protein heterodimer. Alford SC, Abdelfattah AS, Ding Y, Campbell RE. Chem Biol. 2012 Mar 23;19(3):353-60. 10.1016/j.chembiol.2012.01.006 PubMed 22444590