- 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLV-H1TetO-RFP-Puro
 - 
              Backbone manufacturerBiosettia
 - Backbone size w/o insert (bp) 10275
 - 
              Modifications to backboneinsert the shRNA of beta-catenin-2
 - 
              Vector typeMammalian Expression, Lentiviral, RNAi
 - 
                Selectable markersPuromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)Stbl3
 - 
              Growth instructions18 hours at 250 rpm
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameshRNA of beta-catenin-2
 - 
                  Alt nameCTNNB1
 - 
                    gRNA/shRNA sequenceGCTGGTGGAATGCAAGCTT
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)1008
 - 
                        Entrez GeneCTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
 - Promoter TetO-H1
 - 
    
        Tag
        / Fusion Protein
    
- IRES-RFP-Puro (C terminal on backbone)
 
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer AATATTTGCATGTCGCTATGTG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pXL003-ishRNA-beta-catenin-2 was a gift from Sean Palecek (Addgene plasmid # 36299 ; http://n2t.net/addgene:36299 ; RRID:Addgene_36299) - 
                
For your References section:
Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Lian X, Hsiao C, Wilson G, Zhu K, Hazeltine LB, Azarin SM, Raval KK, Zhang J, Kamp TJ, Palecek SP. Proc Natl Acad Sci U S A. 2012 May 29. 10.1073/pnas.1200250109 PubMed 22645348 
Map uploaded by the depositor.