-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36857 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 5694
- Total vector size (bp) 7146
-
Modifications to backbonea hygromysin resistance gene was inserted to facilitate selection for stably transfected cells.
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefluorescent protein voltage sensor
-
Alt nameArcLight
-
Alt nameCi-VSP
-
Alt namesuper ecliptic pHluorin
-
SpeciesCiona intestinalis
-
Insert Size (bp)1452
-
MutationCi-VSP contains R217Q mutation; super ecliptic pHluorin contains A227D mutation
-
GenBank IDAB183035 AY533296
- Promoter semian CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GACGTAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTAAAAAACCTCCCACACCTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
http://www.fluorogenetic-voltage-sensors.org/
This construct is composed of the S1-4 domain of the CiVSP voltage sensor. Super ecliptic pHluorin is inserted at position A242 in the CiVSP sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ArcLight-A242 was a gift from Vincent Pieribone (Addgene plasmid # 36857 ; http://n2t.net/addgene:36857 ; RRID:Addgene_36857) -
For your References section:
Single action potentials and subthreshold electrical events imaged in neurons with a fluorescent protein voltage probe. Jin L, Han Z, Platisa J, Wooltorton JR, Cohen LB, Pieribone VA. Neuron. 2012 Sep 6;75(5):779-85. 10.1016/j.neuron.2012.06.040 PubMed 22958819