pLKO-puro-sh-mFAK B
(Plasmid
#37018)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37018 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 puro (Addgene plasmid 8453)
-
Backbone manufacturerWeinberg lab
- Backbone size w/o insert (bp) 7032
- Total vector size (bp) 7090
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesh-mFAK B
-
Alt nameFAK
-
Alt nameshRNA against mouse FAK
-
gRNA/shRNA sequenceCCTGGCATCTTTGATATTATA
-
SpeciesM. musculus (mouse)
-
Entrez GenePtk2 (a.k.a. FADK 1, FAK, FRNK, Fadk, p125FAK)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-puro-sh-mFAK B was a gift from Bob Weinberg (Addgene plasmid # 37018 ; http://n2t.net/addgene:37018 ; RRID:Addgene_37018) -
For your References section:
Integrin beta1-focal adhesion kinase signaling directs the proliferation of metastatic cancer cells disseminated in the lungs. Shibue T, Weinberg RA. Proc Natl Acad Sci U S A. 2009 Jun 23;106(25):10290-5. Epub 2009 Jun 5. 10.1073/pnas.0904227106 PubMed 19502425