Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCS2TAL3-RR
(Plasmid #37276)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37276 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2
  • Backbone size (bp) 4039
  • Modifications to backbone
    The tal1c sequence from Dan Voytas lab's pTAL3 vector (1214-2210nt) consisting of a truncated N terminal and C terminal Tal protein regions and a LacZ screening module for use in Golden Gate cloning was PCR cloned into the KpnI and BamHI sites of the pCS2-Flag-GAAZFP-FokI-RR from Scot Wolfe's lab, making the new vector pCS2TAL3-RR. A Esp3I site in the FokI domain of the backbone vector was modified without changing the coding sequence.
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Promoter CMV
  • Selectable markers
    LacZ
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • FokI RR (C terminal on backbone)
    • N-terminal Tal from pTAL3 (N terminal on backbone)
    • C terminal Tal From pTAL3 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TTGGCGTCGGCAAACAGTGG
  • 3′ sequencing primer GGCAACGCGATGGGACGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2TAL3-RR was a gift from David Grunwald (Addgene plasmid # 37276 ; http://n2t.net/addgene:37276 ; RRID:Addgene_37276)
  • For your References section:

    Simple Methods for Generating and Detecting Locus-Specific Mutations Induced with TALENs in the Zebrafish Genome. Dahlem TJ, Hoshijima K, Jurynec MJ, Gunther D, Starker CG, Locke AS, Weis AM, Voytas DF, Grunwald DJ. PLoS Genet. 2012 Aug;8(8):e1002861. Epub 2012 Aug 16. 10.1371/journal.pgen.1002861 PubMed 22916025