pCS2TAL3-DD
(Plasmid #37275)

• Purpose: (Empty Backbone) TALEN backbone vector for use with the Golden Gate TALEN Kit in place of pTAL1-4. Shorter N- and C-terminal tal protein segments increases mutation induction; Fok I DD (improved version=pCS2TAL3-DDD)
• Depositing Lab: David Grunwald
• Publication: Dahlem et al PLoS Genet. 2012 Aug;8(8):e1002861. Epub 2012 Aug 16.

Backbone

• Vector backbone: pCS2
• Backbone size (bp): 4168
• Modifications to backbone: The tal1c sequence from Dan Voytas lab's pTAL3 vector (1214-2210nt) consisting of a truncated N terminal and C terminal Tal protein regions and a LacZ screening module for use in Golden Gate cloning was PCR cloned into the KpnI and BamHI sites of the pCS2-Flag-TTGZFP-FokI-DD vector from Scot Wolfe's lab, making the new vector pCS2TAL3-DD. A Esp3I site in the FokI domain of the backbone vector was modified without changing the coding sequence.
• Vector type: Mammalian Expression, Bacterial Expression
• Promoter: CMV
• Selectable markers: LacZ
• Tags / Fusion Proteins:
  • Flag (N terminal on backbone)
  • Fok I DD (C terminal on backbone)
  • Tal-N (N terminal on backbone)
  • Tal-C (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TTGGCGTCGGCAAACAGTGG
• 3′ sequencing primer: GGCAACGCGATGGGACGT

Resource Information

• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald