-
Purpose(Empty Backbone) TALEN backbone vector for use with the Golden Gate TALEN Kit in place of pTAL1-4. Shorter N- and C-terminal tal protein segments increases mutation induction; Fok I DD (improved version=pCS2TAL3-DDD)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2
- Backbone size (bp) 4168
-
Modifications to backboneThe tal1c sequence from Dan Voytas lab's pTAL3 vector (1214-2210nt) consisting of a truncated N terminal and C terminal Tal protein regions and a LacZ screening module for use in Golden Gate cloning was PCR cloned into the KpnI and BamHI sites of the pCS2-Flag-TTGZFP-FokI-DD vector from Scot Wolfe's lab, making the new vector pCS2TAL3-DD. A Esp3I site in the FokI domain of the backbone vector was modified without changing the coding sequence.
-
Vector typeMammalian Expression, Bacterial Expression
- Promoter CMV
-
Selectable markersLacZ
-
Tags
/ Fusion Proteins
- Flag (N terminal on backbone)
- Fok I DD (C terminal on backbone)
- Tal-N (N terminal on backbone)
- Tal-C (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TTGGCGTCGGCAAACAGTGG
- 3′ sequencing primer GGCAACGCGATGGGACGT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2TAL3-DD was a gift from David Grunwald (Addgene plasmid # 37275 ; http://n2t.net/addgene:37275 ; RRID:Addgene_37275) -
For your References section:
Simple Methods for Generating and Detecting Locus-Specific Mutations Induced with TALENs in the Zebrafish Genome. Dahlem TJ, Hoshijima K, Jurynec MJ, Gunther D, Starker CG, Locke AS, Weis AM, Voytas DF, Grunwald DJ. PLoS Genet. 2012 Aug;8(8):e1002861. Epub 2012 Aug 16. 10.1371/journal.pgen.1002861 PubMed 22916025