pMXs-puro HA-Atg14*
(Plasmid
#38265)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 6878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameautophagy related genes 14
-
Alt nameAtg14
-
Alt nameAtg14L
-
Alt nameKIAA0831
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1400
-
Mutationchanged A618T, A621T, C624A and T627C for siRNA resistance
-
GenBank IDAK131251
-
Entrez GeneATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
-
Tag
/ Fusion Protein
- 3xHA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
- 3′ sequencing primer AAAATTAGTCAGCCATGGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFLJ16178, Obtained from the department of biotechnology, National Institute of Technology and Evaluation, Tokyo, Japan
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-puro HA-Atg14* was a gift from Noboru Mizushima (Addgene plasmid # 38265 ; http://n2t.net/addgene:38265 ; RRID:Addgene_38265) -
For your References section:
Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Itakura E, Kishi C, Inoue K, Mizushima N. Mol Biol Cell. 2008 Dec . 19(12):5360-72. 10.1091/mbc.e08-01-0080 PubMed 18843052
Map uploaded by the depositor.
