Skip to main content

pMXs-puro Vps34-GFP
(Plasmid #38268)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38268 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 6878
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Phosphatidylinositol 3-kinase catalytic subunit type 3
  • Alt name
    Vps34
  • Alt name
    Phosphoinositide-3-kinase class 3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2700
  • GenBank ID
    BC033004
  • Entrez Gene
    PIK3C3 (a.k.a. VPS34, Vps34, hVps34)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
  • 3′ sequencing primer GAAGCACTGCACGCCGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vps34 cDNA was provided by Dr. Tamotsu Yoshimori (Osaka University, Osaka, Japan)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-puro Vps34-GFP was a gift from Noboru Mizushima (Addgene plasmid # 38268 ; http://n2t.net/addgene:38268 ; RRID:Addgene_38268)
  • For your References section:

    Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Itakura E, Kishi C, Inoue K, Mizushima N. Mol Biol Cell. 2008 Dec . 19(12):5360-72. 10.1091/mbc.e08-01-0080 PubMed 18843052