Skip to main content

pET11a-4SS-HEWL
(Plasmid #39233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39233 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET11a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5641
  • Total vector size (bp) 6034
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Hen egg white lysozyme
  • Alt name
    HEWL
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    393
  • Mutation
    N-terminal Met
  • GenBank ID
  • Entrez Gene
    LYZ (a.k.a. LYZC, dystrophin)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGCTCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET11a-4SS-HEWL was a gift from Harald Schwalbe (Addgene plasmid # 39233 ; http://n2t.net/addgene:39233 ; RRID:Addgene_39233)
  • For your References section:

    Heterologous expression of hen egg white lysozyme and resonance assignment of tryptophan side chains in its non-native states. Schlorb C, Ackermann K, Richter C, Wirmer J, Schwalbe H. J Biomol NMR. 2005 Oct;33(2):95-104. 10.1007/s10858-005-2063-y PubMed 16258828