pDEST15 hSlp4-a
(Plasmid
#40046)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDEST15
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 9000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21 strain for expression (w/IPTG)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSlp4-a
-
Alt nameSynaptotagmin-like protein 4-a
-
Alt nameSlp4-a WT
-
Alt nameGranuphilin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2025
-
GenBank IDNM_080737
-
Entrez GeneSYTL4 (a.k.a. SLP4)
- Promoter T7
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST15 hSlp4-a was a gift from Fernando Martin-Belmonte (Addgene plasmid # 40046 ; http://n2t.net/addgene:40046 ; RRID:Addgene_40046) -
For your References section:
Synaptotagmin-like proteins control the formation of a single apical membrane domain in epithelial cells. Galvez-Santisteban M, Rodriguez-Fraticelli AE, Bryant DM, Vergarajauregui S, Yasuda T, Banon-Rodriguez I, Bernascone I, Datta A, Spivak N, Young K, Slim CL, Brakeman PR, Fukuda M, Mostov KE, Martin-Belmonte F. Nat Cell Biol. 2012 Jul 22. doi: 10.1038/ncb2541. 10.1038/ncb2541 PubMed 22820376