pcDNA3.1-CD8bM-1
(Plasmid
#40078)
-
Depositing Lab
-
Depositing OrganizationYale University
Located in the United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40078 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 40078-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 40078-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6052
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD8β M-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)652
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer gtacctaggatgcggccgcggctgt
- 3′ sequencing primer gccggtcgactcatttgtaaaattgtttcatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. D.R. Littman, Skirball Institute New York University School of Medicine
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 40078-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 40078-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CD8bM-1 was a gift from Paula Kavathas (Addgene plasmid # 40078 ; http://n2t.net/addgene:40078 ; RRID:Addgene_40078) -
For your References section:
Differential expression of the human CD8beta splice variants and regulation of the M-2 isoform by ubiquitination. Thakral D, Dobbins J, Devine L, Kavathas PB. J Immunol. 2008 Jun 1;180(11):7431-42. PubMed 18490743