Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40078)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 40078 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6052
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    CD8β M-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer gtacctaggatgcggccgcggctgt
  • 3′ sequencing primer gccggtcgactcatttgtaaaattgtttcatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. D.R. Littman, Skirball Institute New York University School of Medicine

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CD8bM-1 was a gift from Paula Kavathas (Addgene plasmid # 40078 ; ; RRID:Addgene_40078)
  • For your References section:

    Differential expression of the human CD8beta splice variants and regulation of the M-2 isoform by ubiquitination. Thakral D, Dobbins J, Devine L, Kavathas PB. J Immunol. 2008 Jun 1;180(11):7431-42. PubMed 18490743