Skip to main content
Addgene

phage-ubc-nls-ha-tdPCP-gfp
(Plasmid #40650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40650 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE-UBC-RIG (modified)
  • Modifications to backbone
    see associated publication
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdPCP-gfp
  • Alt name
    tandem dimer PP7 bacteriophage coat protein (PCP)
  • Species
    Synthetic
  • Insert Size (bp)
    1557
  • Promoter human ubiquitin C (UBC)
  • Tags / Fusion Proteins
    • NLS (N terminal on backbone)
    • HA (N terminal on backbone)
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer FUGW (5'-ATTACAGGGACAGCAGAGATCC-3')
  • 3′ sequencing primer WPRE-R (5'CATAGCGTAAAAGGAGCAACA-3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phage-ubc-nls-ha-tdPCP-gfp was a gift from Robert Singer (Addgene plasmid # 40650 ; http://n2t.net/addgene:40650 ; RRID:Addgene_40650)
  • For your References section:

    Fluorescence fluctuation spectroscopy enables quantitative imaging of single mRNAs in living cells. Wu B, Chao JA, Singer RH. Biophys J. 2012 Jun 20;102(12):2936-44. Epub 2012 Jun 19. 10.1016/j.bpj.2012.05.017 PubMed 22735544