-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+MT
- Backbone size w/o insert (bp) 4352
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNotch-1 Intracellular Domain
-
Alt nameNotch1
-
Alt nameNotch1 Intracellular Domain
-
Alt nameN1
-
SpeciesM. musculus (mouse)
-
MutationContains murine Notch-1 protein beginning at Valine 1744 (aa 1744-2184)
-
GenBank IDNP_032740 BAC77039.1
-
Entrez GeneNotch1 (a.k.a. 9930111A19Rik, Mis6, N1, Tan1, lin-12)
-
Tag
/ Fusion Protein
- 6xMyc (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Sp6
- 3′ sequencing primer EBV-rev
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFull length Notch-1 cDNA from Jeffrey S. Nye (Northwestern University School of Medicine, Chicago, IL)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternate plasmid name: pCS2 NICv1744-6MT
To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2 Notch1 ICv-6MT was a gift from Raphael Kopan (Addgene plasmid # 41730 ; http://n2t.net/addgene:41730 ; RRID:Addgene_41730) -
For your References section:
Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Schroeter EH, Kisslinger JA, Kopan R. Nature. 1998 May 28;393(6683):382-6. 10.1038/30756 PubMed 9620803