pCS2 Notch1 ICv-6MT
(Plasmid #41730)

• Depositing Lab: Raphael Kopan
• Depositing Organization: Washington University in Saint Louis
  Located in United States of America
• Publication: Schroeter et al Nature. 1998 May 28;393(6683):382-6.
• Citations: 3 Articles

Backbone

• Vector backbone: pCS2+MT
• Backbone size w/o insert (bp): 4352
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Notch-1 Intracellular Domain
• Alt name: Notch1
• Alt name: Notch1 Intracellular Domain
• Alt name: N1
• Species: M. musculus (mouse)
• Mutation: Contains murine Notch-1 protein beginning at Valine 1744 (aa 1744-2184)
• GenBank ID: NP_032740 BAC77039.1
• Entrez Gene: Notch1 (a.k.a. 9930111A19Rik, Mis6, N1, Tan1, lin-12)
• Tag / Fusion Protein:
  • 6xMyc (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: Sp6
• 3′ sequencing primer: EBV-rev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Full length Notch-1 cDNA from Jeffrey S. Nye (Northwestern University School of Medicine, Chicago, IL)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: pCS2 NICv1744-6MT

To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).

DNA (Catalog # 41730-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 41730-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.