Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCS2 Notch1 ICv-6MT
(Plasmid #41730)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41730 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+MT
  • Backbone size w/o insert (bp) 4352
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Notch-1 Intracellular Domain
  • Alt name
    Notch1
  • Alt name
    Notch1 Intracellular Domain
  • Alt name
    N1
  • Species
    M. musculus (mouse)
  • Mutation
    Contains murine Notch-1 protein beginning at Valine 1744 (aa 1744-2184)
  • GenBank ID
    NP_032740 BAC77039.1
  • Entrez Gene
    Notch1 (a.k.a. 9930111A19Rik, Mis6, N1, Tan1, lin-12)
  • Tag / Fusion Protein
    • 6xMyc (C terminal on insert)

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Full length Notch-1 cDNA from Jeffrey S. Nye (Northwestern University School of Medicine, Chicago, IL)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternate plasmid name: pCS2 NICv1744-6MT

To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2 Notch1 ICv-6MT was a gift from Raphael Kopan (Addgene plasmid # 41730 ; http://n2t.net/addgene:41730 ; RRID:Addgene_41730)
  • For your References section:

    Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Schroeter EH, Kisslinger JA, Kopan R. Nature. 1998 May 28;393(6683):382-6. 10.1038/30756 PubMed 9620803