-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42131 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3982
- Total vector size (bp) 5419
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHYPER 3
-
SpeciesSynthetic
-
Insert Size (bp)1437
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cggtgggaggtctatataag
- 3′ sequencing primer tgggaggttttttaaagcaag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-HyPer-3 was a gift from Vsevolod Belousov (Addgene plasmid # 42131 ; http://n2t.net/addgene:42131 ; RRID:Addgene_42131) -
For your References section:
HyPer-3: a genetically encoded H2O2 probe with improved performance for ratiometric and fluorescence lifetime imaging. Bilan DS, Pase L, Joosen L, Gorokhovatsky AY, Ermakova YG, Gadella TW, Grabher C, Schultz C, Lukyanov S, Belousov VV. ACS Chem Biol. 2012 Dec 20. 10.1021/cb300625g PubMed 23256573