Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV-GR-GECO1.2
(Plasmid #42187)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42187 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    modified pcDNA3.1
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 4500
  • Modifications to backbone
    The SV40 promoter, the SV40 origin of replication, the Neomycin ORF, and the SV40 poly A region in the original pcDNA3.1 was deleted.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GR-GECO1.2
  • Alt name
    green-to-red photoconvertible Ca2+ indicator
  • Species
    Synthetic
  • Insert Size (bp)
    1260
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-GR-GECO1.2 was a gift from Robert Campbell (Addgene plasmid # 42187 ; http://n2t.net/addgene:42187 ; RRID:Addgene_42187)
  • For your References section:

    Highlightable Ca(2+) Indicators for Live Cell Imaging. Hoi H, Matsuda T, Nagai T, Campbell RE. J Am Chem Soc. 2012 Dec 26. 10.1021/ja310184a PubMed 23256581