Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #42198)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 42198 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 5300
  • Modifications to backbone
    The TorA protein export plasmid (pTorPE) was constructed by inserting a digested DNA fragment encoding TorA-6×His-GCaMP3-SsrA into the NcoI/HindII sites of pBAD/His B (Invitrogen).
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    green-to-red photoconvertible Ca2+ indicator
  • Species
  • Insert Size (bp)
  • Promoter araBAD
  • Tag / Fusion Protein
    • 6His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTorPE-GR-GECO1.1 was a gift from Robert Campbell (Addgene plasmid # 42198 ; ; RRID:Addgene_42198)
  • For your References section:

    Highlightable Ca(2+) Indicators for Live Cell Imaging. Hoi H, Matsuda T, Nagai T, Campbell RE. J Am Chem Soc. 2012 Dec 26. 10.1021/ja310184a PubMed 23256581