Skip to main content

pMALp2x-SCO5461(E164D)(43-204)
(Plasmid #42508)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42508 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMAL-p2x
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6715
  • Total vector size (bp) 7330
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Growth instructions
    Use rich media (terrific broth, etc.) for protein expression.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    guanosine ADP-ribosyltransferase
  • Alt name
    SCO5461
  • Alt name
    ScARP
  • Alt name
    NAD+:guanine-N2-ADP-D-ribosyltransferase
  • Species
    Streptomyces coelicolor A3(2)
  • Insert Size (bp)
    489
  • Mutation
    Deleted amino acids 1-42 (nucleotide 1-126); changed Glutamic acid 164 to Aspartic acid (guanosine 492 to cytosine)
  • GenBank ID
    AL939123.1:267130..267744 CAB76015.1
  • Entrez Gene
    SCO5461 (a.k.a. SCO5461, SC3D11.18)
  • Promoter tac
  • Tag / Fusion Protein
    • maltose-binding protein (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ggtcgtcagactgtcgatgaagcc
  • 3′ sequencing primer gtaaaacgacggccag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMALp2x-SCO5461(E164D)(43-204) was a gift from Koji Okamoto (Addgene plasmid # 42508 ; http://n2t.net/addgene:42508 ; RRID:Addgene_42508)
  • For your References section:

    ADP-ribosylation of guanosine by SCO5461 protein secreted from Streptomyces coelicolor. Nakano T, Matsushima-Hibiya Y, Yamamoto M, Takahashi-Nakaguchi A, Fukuda H, Ono M, Takamura-Enya T, Kinashi H, Totsuka Y. Toxicon. 2012 Dec 2;63C:55-63. doi: 10.1016/j.toxicon.2012.11.019. 10.1016/j.toxicon.2012.11.019 PubMed 23212047