Skip to main content

pCAG-AILR-LplA-ER
(Plasmid #42574)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42574 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4261
  • Total vector size (bp) 7786

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LplA(AILR) with ER-retention sequence KDEL
  • Species
    E. coli
  • Mutation
    Compared to wild-type LplA: tryptophan 37 to alanine; threonine 57 to isoleucine; phenylalanine 147 to leucine; histidine 267 to arginine
  • Promoter CAG
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCCGCCGTCCCCTTCTCCATCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-AILR-LplA-ER was a gift from Alice Ting (Addgene plasmid # 42574 ; http://n2t.net/addgene:42574 ; RRID:Addgene_42574)
  • For your References section:

    Quantum Dot Targeting with Lipoic Acid Ligase and HaloTag for Single-Molecule Imaging on Living Cells. Liu DS, Phipps WS, Loh KH, Howarth M, Ting AY. ACS Nano. 2012 Dec 21;6(12):11080-7. doi: 10.1021/nn304793z. Epub 2012 Dec 5. 10.1021/nn304793z PubMed 23181687