Skip to main content

pHes1(467 RBPj(-))-luc
(Plasmid #43805)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 43805 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL2-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5597
  • Total vector size (bp) 6110
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hes1 Promoter (-467 to +46) RBPj(-)
  • Alt name
    Hes1
  • Alt name
    hairy and enhancer of split 1 Promoter (-467 to +46) RBPj(-)
  • Alt name
    hairy and enhancer of split 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    513
  • Mutation
    Contains the murine Hes1 promoter (-467 to +46), lacks the RBP-J site (see below)
  • GenBank ID
    NC_000082.6
  • Entrez Gene
    Hes1 (a.k.a. Hry, bHLHb39)
  • Promoter Hes1 promoter fragment (-467 to +46) (RBPj-)
  • Tag / Fusion Protein
    • Firefly luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternate plasmid name: Hes1/RBP-J (-)

This construct contains the murine Hes1 promoter lacking the RBP-J site.

Relevant sequence portion:
WT: -86 /TGTGGGAAAGAAAGTTTGGGAAGTTT/ -61
Rbp J(-): -86 /TGTG[CTGC]AGAAAgtTT[CTCG]AGTTT/ -61 (mutated sequences are bracketed)

In Rbp J(-), PstI (CTGCAG) and XhoI (CTCGAG) sites are introduced.

Addgene quality control discovered a 2-base deletion (lower case letters) in the murine Hes1 promoter. This should not affect the function, and the vector is OK.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHes1(467 RBPj(-))-luc was a gift from Ryoichiro Kageyama (Addgene plasmid # 43805 ; http://n2t.net/addgene:43805 ; RRID:Addgene_43805)
  • For your References section:

    Structure, chromosomal locus, and promoter of mouse Hes2 gene, a homologue of Drosophila hairy and Enhancer of split. Nishimura M, Isaka F, Ishibashi M, Tomita K, Tsuda H, Nakanishi S, Kageyama R. Genomics. 1998 Apr 1;49(1):69-75. 10.1006/geno.1998.5213 PubMed 9570950