-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 43918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFU-tetO-Gateway
-
Backbone manufacturerAddgene plasmid 43914
- Backbone size w/o insert (bp) 8600
- Total vector size (bp) 12400
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
-
Selectable markersZeo marker is outside the LTRs and will not be packaged into virus.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recA cells, such as STBL3 (Invitrogen)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASCL1-2A-LMX1B-2A-NURR1
-
Alt nameASCL1
-
Alt nameLMX1B
-
Alt nameNURR1 (NR4A2)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3800
-
MutationGylcine-serine-glycine (GSG) linker followed by viral 2A peptide sequence inserted between each ORF
-
GenBank IDDQ894571/EL736297/EU832740 (Genbank Accession Numbers) 100009031/13957/100067769 (Open Biosystems IDs)
-
Entrez GeneASCL1 (a.k.a. ASH1, HASH1, MASH1, bHLHa46)
-
Entrez GeneLMX1B (a.k.a. FSGS10, LMX1.2, NPS1)
-
Entrez GeneNR4A2 (a.k.a. HZF-3, IDLDP, NOT, NURR1, RNR1, TINUR)
- Promoter TRE promoter, Tet-ON
-
Tags
/ Fusion Proteins
- V5 (C terminal on backbone)
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX; T7
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byASCL1, LMX1B, and NURR1 ORF cDNAs purchased from Open Biosystems (Now part of Thermo Scientific, Waltham, MA)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To make a drug-inducible lentiviral vector that is compatible with Gateway recombination (Invitrogen), the depositing laboratory removed the OCT4 open reading frame from FU-tetO-hOCT4 (Addgene plasmid 19778) and replaced it with a Gateway cassette cloned from pEF-DEST51 (Invitrogen) to generate FU-tetO-Gateway (Addgene plasmid #43914).
Open reading frames of human ASCL1, LMX1B, and NURR1 were purchased from Open Biosystems and amplified using the following PCR primers:
B1-ASCL1-FWD: GGGGacaagtttgtacaaaaaagcaggctACCATGGAAAGCTCTGCCAAG;
ASCL1-REV: CATCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCACCGGATCCGAACCAGTTGGTGAAGTC;
LMX1B-FWD: CTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCTATGTTGGACGGCATCAAG;
LMX1B-REV: ACGTCACCGCATGTTAGAAGACTTCCTCTGCCCTCTCCGGATCCGGAGGCGAAGTAGGAACT;
NURR1-FWD: GAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTATGCCTTGTGTTCAGGCG;
B2-NURR1-REV: GGGGaccactttgtacaagaaagctgggt[A]GAAAGGTAAAGTGTCCAG
(extra [A] added to maintain reading frame with C-terminal V5-tag).
The 3 ORFs were then joined via recombinant PCR such that viral 2A peptide sequences separate the three genes, using B1-ASCL1-FWD and B2-NURR1-REV. A glycine-serine-glycine (GSG) linker was included upstream of each 2A sequence to facilitate protein cleavage.
The ASCL1-P2A-LMX1B-T2A-NURR1(ALN) cassette was cloned into pDONR221, and subsequently cloned into FU-tetO-Gateway via Gateway recombination to produce the tetO-ALN vector.
Cleavage at 2A sites was verified by performing in vitro transcription and translation using the TnT T7 Coupled Reticulocyte Lysate System (Promega L4610) in the presence of biotinylated lysine (Promega L5061). 5 µL of each TnT-generated protein sample was resolved via PAGE, transferred to PVDF membrane, incubated with streptavidin-conjugated horseradish peroxidase (Cell Signaling Technology 3999, 1:2000), and detected with ECL Plus (GE Healthcare RPN2132).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tetO-ALN was a gift from John Gearhart (Addgene plasmid # 43918 ; http://n2t.net/addgene:43918 ; RRID:Addgene_43918) -
For your References section:
Efficient conversion of astrocytes to functional midbrain dopaminergic neurons using a single polycistronic vector. Addis RC, Hsu FC, Wright RL, Dichter MA, Coulter DA, Gearhart JD. PLoS One. 2011;6(12):e28719. doi: 10.1371/journal.pone.0028719. Epub 2011 Dec 9. 10.1371/journal.pone.0028719 PubMed 22174877