Skip to main content

pIC242
(Plasmid #44432)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44432 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBabe
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 6672
  • Modifications to backbone
    The plasmid contains a blasticidin resistant gene for selection in eukaryotic cells.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mob1A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    700
  • Mutation
    F5L, K15R and G212R
  • Entrez Gene
    MOB1A (a.k.a. C2orf6, MATS1, MOB1, MOBK1B, MOBKL1B, Mob4B)
  • Tags / Fusion Proteins
    • GFP (N terminal on backbone)
    • tev (N terminal on insert)
    • s peptide (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII/EcoRI (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

F5L, K15R and G212R mutations in Mob1A when compared to GenBank reference sequence NM_018221.3

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIC242 was a gift from Iain Cheeseman & Arshad Desai (Addgene plasmid # 44432 ; http://n2t.net/addgene:44432 ; RRID:Addgene_44432)
  • For your References section:

    A combined approach for the localization and tandem affinity purification of protein complexes from metazoans. Cheeseman IM, Desai A. Sci STKE. 2005 Jan 11;2005(266):pl1. 10.1126/stke.2662005pl1 PubMed 15644491