Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #44471)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 44471 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6300
  • Total vector size (bp) 8700
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    Notch intracellular domain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    Contains amino acid 1753 to C-Term
  • Entrez Gene
    Notch1 (a.k.a. 9930111A19Rik, Mi, Mis6, N, N1, Ta, Tan1, lin, lin-12)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Jeffrey Nye generated the NICD cDNA. Reference: Development 120, 2421-2430 (1994).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPCX-NICD was a gift from Ernesto Canalis (Addgene plasmid # 44471 ; ; RRID:Addgene_44471)
  • For your References section:

    Reciprocal regulation of Notch and nuclear factor of activated T-cells (NFAT) c1 transactivation in osteoblasts. Zanotti S, Smerdel-Ramoya A, Canalis E. J Biol Chem. 2011 Feb 11;286(6):4576-88. doi: 10.1074/jbc.M110.161893. Epub 2010 Dec 3. 10.1074/jbc.M110.161893 PubMed 21131365