pDN-T2dMFot
(Plasmid
#44558)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS404
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4274
- Total vector size (bp) 5320
-
Modifications to backboneCYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites).
-
Vector typeYeast Expression, Synthetic Biology ; Expression regulator/reporter
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePTETREG promoter
-
Alt nameYeast ADH1 transcriptional term. and two copies of the tetO2 operator site upstream of the PCYC1 TATA box and minimal promoter
-
Alt namertTA-MF inducible promoter
-
SpeciesSynthetic
-
Insert Size (bp)504
- Promoter PTETREG
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer F1ori-R (AGGGAAGAAAGCGAAAGGAG)
- 3′ sequencing primer Tet-R (GGCGAGTTTACGGGTTGTTA) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namertetR-M2::FFF
-
Alt namemodified rtTA transactivator (rtTA-MF)
-
Alt namertetR-M2 transactivator variant augmented with the short FFF activation domain
-
Alt nameThree VP16-derived "F-type" minimal acidic activation domains
-
SpeciesSynthetic; E. Coli
-
Insert Size (bp)750
-
MutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D148E, and H179R
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TetR-F1 (TTGATCACCAAGGTGCAGAG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPTETREG promoter from plasmid pBB247 from Attila Becskei and Luis Serrano, EMBL Heidelberg, Germany. Modified Tet transactivator rtetR-M2 from plasmid pCM190-M2 from Wolfgang Hiller, Friedrich-Alexander-Universität Erlangen-Nürnberg, Germany. VP16-derived "F-type" minimal acidic activation domain described by Hermann Bujard, ZMBH, Heidelberg, Germany.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDN-T2dMFot was a gift from Gabor Balazsi (Addgene plasmid # 44558 ; http://n2t.net/addgene:44558 ; RRID:Addgene_44558) -
For your References section:
Mapping the environmental fitness landscape of a synthetic gene circuit. Nevozhay D, Adams RM, Van Itallie E, Bennett MR, Balazsi G. PLoS Comput Biol. 2012;8(4):e1002480. doi: 10.1371/journal.pcbi.1002480. Epub 2012 Apr 12. 10.1371/journal.pcbi.1002480 PubMed 22511863