Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDN-T2dMFot
(Plasmid #44558)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44558 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS404
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4274
  • Total vector size (bp) 5320
  • Modifications to backbone
    CYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites).
  • Vector type
    Yeast Expression, Synthetic Biology ; Expression regulator/reporter
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PTETREG promoter
  • Alt name
    Yeast ADH1 transcriptional term. and two copies of the tetO2 operator site upstream of the PCYC1 TATA box and minimal promoter
  • Alt name
    rtTA-MF inducible promoter
  • Species
    Synthetic
  • Insert Size (bp)
    504
  • Promoter PTETREG

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer F1ori-R (AGGGAAGAAAGCGAAAGGAG)
  • 3′ sequencing primer Tet-R (GGCGAGTTTACGGGTTGTTA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rtetR-M2::FFF
  • Alt name
    modified rtTA transactivator (rtTA-MF)
  • Alt name
    rtetR-M2 transactivator variant augmented with the short FFF activation domain
  • Alt name
    Three VP16-derived "F-type" minimal acidic activation domains
  • Species
    Synthetic; E. Coli
  • Insert Size (bp)
    750
  • Mutation
    Compared to rtTA, rtTA-M2 has S12G, E19G, A56P, D148E, and H179R

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TetR-F1 (TTGATCACCAAGGTGCAGAG)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    PTETREG promoter from plasmid pBB247 from Attila Becskei and Luis Serrano, EMBL Heidelberg, Germany. Modified Tet transactivator rtetR-M2 from plasmid pCM190-M2 from Wolfgang Hiller, Friedrich-Alexander-Universität Erlangen-Nürnberg, Germany. VP16-derived "F-type" minimal acidic activation domain described by Hermann Bujard, ZMBH, Heidelberg, Germany.
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-T2dMFot was a gift from Gabor Balazsi (Addgene plasmid # 44558 ; http://n2t.net/addgene:44558 ; RRID:Addgene_44558)
  • For your References section:

    Mapping the environmental fitness landscape of a synthetic gene circuit. Nevozhay D, Adams RM, Van Itallie E, Bennett MR, Balazsi G. PLoS Comput Biol. 2012;8(4):e1002480. doi: 10.1371/journal.pcbi.1002480. Epub 2012 Apr 12. 10.1371/journal.pcbi.1002480 PubMed 22511863