Skip to main content

pDN-T2dGZmxh
(Plasmid #44552)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44552 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRS403
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4456
  • Total vector size (bp) 5941
  • Modifications to backbone
    CYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites). Small region of additional homology to the his3 locus inserted in front of the HIS3 gene (between AhdI and AfeI sites) to facilitate integration.
  • Vector type
    Yeast Expression, Synthetic Biology ; Expression regulator/reporter
  • Selectable markers
    Zeocin, HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PTETREG promoter
  • Alt name
    Yeast ADH1 transcriptional term. and two copies of the tetO2 operator site upstream of the PCYC1 TATA box and minimal promoter
  • Alt name
    rtTA-MF inducible promoter
  • Species
    Synthetic
  • Insert Size (bp)
    504
  • Promoter PTETREG

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer F1ori-R (AGGGAAGAAAGCGAAAGGAG)
  • 3′ sequencing primer GFP-R
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    yEGFP::ZeoR
  • Alt name
    yeast-enhanced green fluorescent protein
  • Alt name
    Bleomycin/Zeocin resistance protein
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    1111

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer Zeo-R (ctgatgaacagggtcacgtc)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PTETREG promoter from plasmid pBB247 from Attila Becskei and Luis Serrano, EMBL Heidelberg, Germany

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmids was created as follows. First, the PTETREG promoter consisting of two tetO2 sites upstream of the minimal PCYC1 promoter was amplified from the pBB247 plasmid (Becskei, Séraphin, and Serrano, EMBO 2001, PMID: 11350942), and inserted into the pDN-G1GZmh plasmid between the AflII and BamHI sites instead of the PGAL1-D12 promoter resulting in the pDN-T2dGZmh plasmid. In order to facilitate the planned integration of the reporter plasmid into the his3Δ200 locus of the YPH500 strain, a small region bearing homology to the his3Δ200 locus was constructed by PCR and inserted in front of the HIS3 gene between the AhdI and AfeI sites of the pDN-T2dGZmh plasmid, resulting in the pDN-T2dGZmlh plasmid. Next, a second ADH1 terminator was removed from the pDN-T2dGZmlh plasmid, resulting in the final reporter pDN-T2dGZmxh plasmid bearing the yEGFP::zeoR fluorescent reporter gene under the control of the PTETREG rtTA-MF inducible promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-T2dGZmxh was a gift from Gabor Balazsi (Addgene plasmid # 44552 ; http://n2t.net/addgene:44552 ; RRID:Addgene_44552)
  • For your References section:

    Mapping the environmental fitness landscape of a synthetic gene circuit. Nevozhay D, Adams RM, Van Itallie E, Bennett MR, Balazsi G. PLoS Comput Biol. 2012;8(4):e1002480. doi: 10.1371/journal.pcbi.1002480. Epub 2012 Apr 12. 10.1371/journal.pcbi.1002480 PubMed 22511863